Use ShortStack (Axtell 2013; Johnson et al. 2016; Shahid and Axtell 2014) to perform alignment of sRNAseq data and annotation of sRNA-producing genes.
Inputs:
Requires trimmed sRNAseq files generated by 06-Peve-sRNAseq-trimming.Rmd
*flexbar_trim.25bp*.gzA.millepora genome FastA. See 07-Peve-sRNAseq-MirMachine.md for download info if needed.
Outputs:
Software requirements:
Replace with name of your ShortStack environment and the path to the corresponding conda installation (find this after you’ve activated the environment).
E.g.
# Activate environment
conda activate ShortStack4_env
# Find conda path
which conda
shortstack_conda_env_name <- c("ShortStack4_env")
shortstack_cond_path <- c("/home/sam/programs/mambaforge/condabin/conda")
This allows usage of Bash variables across R Markdown chunks.
{
echo "#### Assign Variables ####"
echo ""
echo "# Trimmed FastQ naming pattern"
echo "export trimmed_fastqs_pattern='*flexbar_trim.25bp*.fastq.gz'"
echo "# Data directories"
echo 'export deep_dive_dir=/home/shared/8TB_HDD_01/sam/gitrepos/deep-dive'
echo 'export deep_dive_data_dir="${deep_dive_dir}/data"'
echo 'export output_dir_top=${deep_dive_dir}/E-Peve/output/08-Peve-sRNAseq-ShortStack'
echo 'export trimmed_fastqs_dir="${deep_dive_dir}/E-Peve/output/06-Peve-sRNAseq-trimming/trimmed-reads"'
echo ""
echo "# Input/Output files"
echo 'export genome_fasta_dir=${deep_dive_dir}/E-Peve/data'
echo 'export genome_fasta_name="Porites_evermanni_v1.fa"'
echo 'export shortstack_genome_fasta_name="Porites_evermanni_v1.fa"'
echo 'export mirbase_mature_fasta=mature.fa'
echo 'export mirbase_mature_fasta_version=mirbase-mature-v22.1.fa'
echo 'export genome_fasta="${genome_fasta_dir}/${shortstack_genome_fasta_name}"'
echo ""
echo "# External data URLs"
echo 'export mirbase_fasta_url="https://mirbase.org/download_version_files/22.1/"'
echo ""
echo "# Set number of CPUs to use"
echo 'export threads=46'
echo ""
echo "# Initialize arrays"
echo 'export trimmed_fastqs_array=()'
} > .bashvars
cat .bashvars
#### Assign Variables ####
# Trimmed FastQ naming pattern
export trimmed_fastqs_pattern='*flexbar_trim.25bp*.fastq.gz'
# Data directories
export deep_dive_dir=/home/shared/8TB_HDD_01/sam/gitrepos/deep-dive
export deep_dive_data_dir="${deep_dive_dir}/data"
export output_dir_top=${deep_dive_dir}/E-Peve/output/08-Peve-sRNAseq-ShortStack
export trimmed_fastqs_dir="${deep_dive_dir}/E-Peve/output/06-Peve-sRNAseq-trimming/trimmed-reads"
# Input/Output files
export genome_fasta_dir=${deep_dive_dir}/E-Peve/data
export genome_fasta_name="Porites_evermanni_v1.fa"
export shortstack_genome_fasta_name="Porites_evermanni_v1.fa"
export mirbase_mature_fasta=mature.fa
export mirbase_mature_fasta_version=mirbase-mature-v22.1.fa
export genome_fasta="${genome_fasta_dir}/${shortstack_genome_fasta_name}"
# External data URLs
export mirbase_fasta_url="https://mirbase.org/download_version_files/22.1/"
# Set number of CPUs to use
export threads=46
# Initialize arrays
export trimmed_fastqs_array=()
If this is successful, the first line of output should show that the Python being used is the one in your [ShortStack](https://github.com/MikeAxtell/ShortStack conda environment path.
E.g.
python:         /home/sam/programs/mambaforge/envs/mirmachine_env/bin/python
use_condaenv(condaenv = shortstack_conda_env_name, conda = shortstack_cond_path)
# Check successful env loading
py_config()
python:         /home/sam/programs/mambaforge/envs/ShortStack4_env/bin/python
libpython:      /home/sam/programs/mambaforge/envs/ShortStack4_env/lib/libpython3.10.so
pythonhome:     /home/sam/programs/mambaforge/envs/ShortStack4_env:/home/sam/programs/mambaforge/envs/ShortStack4_env
version:        3.10.13 | packaged by conda-forge | (main, Oct 26 2023, 18:07:37) [GCC 12.3.0]
numpy:          /home/sam/programs/mambaforge/envs/ShortStack4_env/lib/python3.10/site-packages/numpy
numpy_version:  1.26.0
NOTE: Python version was forced by use_python() function
# Load bash variables into memory
source .bashvars
wget \
--directory-prefix ${deep_dive_data_dir} \
--recursive \
--no-check-certificate \
--continue \
--no-host-directories \
--no-directories \
--no-parent \
--quiet \
--execute robots=off \
 ${mirbase_fasta_url}/${mirbase_mature_fasta}
# Rename to indicate miRBase FastA version
mv ${deep_dive_data_dir}/${mirbase_mature_fasta} ${deep_dive_data_dir}/${mirbase_mature_fasta_version}
ls -lh "${deep_dive_data_dir}"
total 13M
drwxr-xr-x 2 sam sam 4.0K Nov  7 14:36 blast_dbs
-rw-r--r-- 1 sam sam 3.7M Nov 15 21:30 mirbase-mature-v22.1.fa
-rw-r--r-- 1 sam sam 3.7M Nov 14 09:39 mirbase-mature-v22.1-no_spaces.fa
-rw-r--r-- 1 sam sam 3.7M Nov  7 14:31 mirbase-mature-v22.1-no_U.fa
-rw-r--r-- 1 sam sam 726K Nov  7 14:36 mirgene-mature-all-v2.1.fa
-rw-r--r-- 1 sam sam 726K Nov  7 14:31 mirgene-mature-all-v2.1-no_U.fa
Uses the --dn_mirna option to identify miRNAs in the genome, without relying on the --known_miRNAs.
This part of the code redirects the output of time to the end of shortstack.log file.
; } \ 2>> ${output_dir_top}/shortstack.log# Load bash variables into memory
source .bashvars
# Create array of trimmed FastQs
trimmed_fastqs_array=(${trimmed_fastqs_dir}/${trimmed_fastqs_pattern})
# Pass array contents to new variable as space-delimited list
trimmed_fastqs_list=$(echo "${trimmed_fastqs_array[*]}")
###### Run ShortStack ######
{ time \
ShortStack \
--genomefile "${genome_fasta}" \
--readfile ${trimmed_fastqs_list} \
--known_miRNAs ${deep_dive_data_dir}/${mirbase_mature_fasta_version} \
--dn_mirna \
--threads ${threads} \
--outdir ${output_dir_top}/ShortStack_out \
&> ${output_dir_top}/shortstack.log ; } \
2>> ${output_dir_top}/shortstack.log
# Load bash variables into memory
source .bashvars
tail -n 3 ${output_dir_top}/shortstack.log \
| grep "real" \
| awk '{print "ShortStack runtime:" "\t" $2}'
ShortStack runtime: 75m11.616s
# Load bash variables into memory
source .bashvars
tail -n 20 ${output_dir_top}/shortstack.log
Screening of possible de novo microRNAs
No microRNA loci were found!
Writing final files
Non-MIRNA loci by DicerCall:
N 14896
22 56
23 43
24 24
21 21
Wed 15 Nov 2023 20:35:51 -0800 PST
Run Completed!
real    75m11.616s
user    1670m15.527s
sys 461m28.418s
ShortStack didn’t identify any miRNAs.
Results.txt# Load bash variables into memory
source .bashvars
head ${output_dir_top}/ShortStack_out/Results.txt
echo ""
echo "----------------------------------------------------------"
echo ""
echo "Nummber of potential loci:"
awk '(NR>1)' ${output_dir_top}/ShortStack_out/Results.txt | wc -l
Locus   Name    Chrom   Start   End Length  Reads   UniqueReads FracTop Strand  MajorRNA    MajorRNAReads   Short   Long    21  22  23  24  DicerCall   MIRNA   known_miRNAs
Porites_evermani_scaffold_1:45716-46125 Cluster_1   Porites_evermani_scaffold_1 45716   46125   410 215 93  0.49767441860465117 .   ACUGAUUCUUGGCCACCUCUACUGU   9   45  96  18  16  18  22  N   N   NA
Porites_evermani_scaffold_1:406307-406731   Cluster_2   Porites_evermani_scaffold_1 406307  406731  425 340 103 0.5029411764705882  .   UGAGUGUAUUCUUGAACUGUUUUCC   73  2   314 2   1   9   12  N   N   NA
Porites_evermani_scaffold_1:409840-410269   Cluster_3   Porites_evermani_scaffold_1 409840  410269  430 365 55  0.4876712328767123  .   UGGAACUCCGAUUUAGAACUUGCAA   124 0   355 1   3   0   6   N   N   NA
Porites_evermani_scaffold_1:465246-465668   Cluster_4   Porites_evermani_scaffold_1 465246  465668  423 371 97  0.49326145552560646 .   AAGUUGCUCUGAAGAUUAUGU   39  66  140 96  15  40  14  N   N   NA
Porites_evermani_scaffold_1:468473-468950   Cluster_5   Porites_evermani_scaffold_1 468473  468950  478 231785  1297    0.49824190521388356 .   AAUUCAGAAAAACUGAACAGUCAUC   89861   3892    224933  229 276 305 2150    N   N   NA
Porites_evermani_scaffold_1:476827-477250   Cluster_6   Porites_evermani_scaffold_1 476827  477250  424 241 67  0.4896265560165975  .   CGUGUCUUCGUAAUCGUCUCGUACA   14  66  85  0   24  30  36  N   N   NA
Porites_evermani_scaffold_1:486444-486864   Cluster_7   Porites_evermani_scaffold_1 486444  486864  421 116 17  0.49137931034482757 .   AUAUUGACGAAUCCUGGCCUAGUGA   49  0   108 0   0   8   0   N   N   NA
Porites_evermani_scaffold_1:534428-534866   Cluster_8   Porites_evermani_scaffold_1 534428  534866  439 1252    200 0.4976038338658147  .   AGCCAAAGCUAUAAGUUUACGUCUC   298 62  892 120 28  70  80  N   N   NA
Porites_evermani_scaffold_1:729098-729587   Cluster_9   Porites_evermani_scaffold_1 729098  729587  490 13328   605 0.49797418967587037 .   UGUGGUCAGACAGUUCUGGCUUGUC   4355    409 11693   262 478 244 242 N   N   NA
----------------------------------------------------------
Nummber of potential loci:
15040
Column 20 of the Results.txt file identifies if a cluster is a miRNA or not (Y or N).
# Load bash variables into memory
source .bashvars
echo "Number of loci characterized as miRNA:"
awk '$20=="Y" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l
echo ""
echo "----------------------------------------------------------"
echo ""
echo "Number of loci _not_ characterized as miRNA:"
awk '$20=="N" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l
Number of loci characterized as miRNA:
0
----------------------------------------------------------
Number of loci _not_ characterized as miRNA:
15040
Column 21 of the Results.txt file identifies if a cluster aligned to a known miRNA (miRBase) or not (Y or NA).
Since there are no miRNAs, the following code will not print any output.
The echo command after the awk command is simply there to prove that the chunk executed.
# Load bash variables into memory
source .bashvars
echo "Number of loci matching miRBase miRNAs:"
awk '$21!="NA" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l
echo ""
echo "----------------------------------------------------------"
echo ""
echo "Number of loci _not_ matching miRBase miRNAs:"
awk '$21=="NA" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l
Number of loci matching miRBase miRNAs:
25
----------------------------------------------------------
Number of loci _not_ matching miRBase miRNAs:
15016
Although there are loci with matches to miRBase miRNAs, ShortStack did not annotate these clusters as miRNAs likely because they do not also match secondary structure criteria.
Many of these are large (by GitHub standards) BAM files, so will not be added to the repo.
Additionally, it’s unlikely we’ll utilize most of the other files (bigwig) generated by ShortStack.
# Load bash variables into memory
source .bashvars
tree -h ${output_dir_top}/
/home/shared/8TB_HDD_01/sam/gitrepos/deep-dive/E-Peve/output/08-Peve-sRNAseq-ShortStack/
├── [ 21K]  shortstack.log
└── [228K]  ShortStack_out
    ├── [ 28K]  alignment_details.tsv
    ├── [1.1M]  Counts.txt
    ├── [204K]  known_miRNAs.gff3
    ├── [1.8M]  known_miRNAs_unaligned.fasta
    ├── [ 11M]  merged_alignments_21_m.bw
    ├── [ 11M]  merged_alignments_21_p.bw
    ├── [ 10M]  merged_alignments_22_m.bw
    ├── [ 10M]  merged_alignments_22_p.bw
    ├── [ 17M]  merged_alignments_23-24_m.bw
    ├── [ 17M]  merged_alignments_23-24_p.bw
    ├── [1.3G]  merged_alignments.bam
    ├── [348K]  merged_alignments.bam.csi
    ├── [ 77M]  merged_alignments_other_m.bw
    ├── [ 79M]  merged_alignments_other_p.bw
    ├── [ 32M]  merged_alignments_sRNA-POR-73-S1-TP2.flexbar_trim.25bp_1.bw
    ├── [ 33M]  merged_alignments_sRNA-POR-73-S1-TP2.flexbar_trim.25bp_2.bw
    ├── [ 45M]  merged_alignments_sRNA-POR-79-S1-TP2.flexbar_trim.25bp_1.bw
    ├── [ 45M]  merged_alignments_sRNA-POR-79-S1-TP2.flexbar_trim.25bp_2.bw
    ├── [ 51M]  merged_alignments_sRNA-POR-82-S1-TP2.flexbar_trim.25bp_1.bw
    ├── [ 51M]  merged_alignments_sRNA-POR-82-S1-TP2.flexbar_trim.25bp_2.bw
    ├── [1.7M]  Results.gff3
    ├── [2.6M]  Results.txt
    ├── [200M]  sRNA-POR-73-S1-TP2.flexbar_trim.25bp_1.bam
    ├── [303K]  sRNA-POR-73-S1-TP2.flexbar_trim.25bp_1.bam.csi
    ├── [206M]  sRNA-POR-73-S1-TP2.flexbar_trim.25bp_2.bam
    ├── [304K]  sRNA-POR-73-S1-TP2.flexbar_trim.25bp_2.bam.csi
    ├── [219M]  sRNA-POR-79-S1-TP2.flexbar_trim.25bp_1.bam
    ├── [309K]  sRNA-POR-79-S1-TP2.flexbar_trim.25bp_1.bam.csi
    ├── [228M]  sRNA-POR-79-S1-TP2.flexbar_trim.25bp_2.bam
    ├── [310K]  sRNA-POR-79-S1-TP2.flexbar_trim.25bp_2.bam.csi
    ├── [243M]  sRNA-POR-82-S1-TP2.flexbar_trim.25bp_1.bam
    ├── [314K]  sRNA-POR-82-S1-TP2.flexbar_trim.25bp_1.bam.csi
    ├── [251M]  sRNA-POR-82-S1-TP2.flexbar_trim.25bp_2.bam
    └── [315K]  sRNA-POR-82-S1-TP2.flexbar_trim.25bp_2.bam.csi
1 directory, 35 files