Basic Statistics
| Measure | Value |
|---|---|
| Filename | POC-219-TP1_R2_001.fastq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 20746812 |
| Total Bases | 3.1 Gbp |
| Sequences flagged as poor quality | 0 |
| Sequence length | 150 |
| %GC | 41 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG | 119558 | 0.5762716700763472 | No Hit |
| GTTGTAATAATTTTTACATAAGTAATCTAAATATTATTTTTTTTTCTTAA | 29189 | 0.14069149515597867 | No Hit |
| GTTTTTTAAAAAGTAACGAAAATGAGCTATGACGCATGTTTAACTTTGAA | 23757 | 0.11450915928673765 | No Hit |