Basic Statistics
| Measure | Value |
|---|---|
| Filename | Geoduck-ctenidia-RNA-5_S35_L005_R1_001.fastq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 961561 |
| Sequences flagged as poor quality | 0 |
| Sequence length | 35-151 |
| %GC | 36 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC | 87323 | 9.081379132473135 | TruSeq Adapter, Index 12 (100% over 50bp) |
| ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCC | 10798 | 1.122965677684515 | TruSeq Adapter, Index 12 (100% over 50bp) |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | 2638 | 0.27434556933985466 | No Hit |
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | 1541 | 0.16026024349989237 | No Hit |