Basic Statistics
| Measure | Value |
|---|---|
| Filename | SRR3321208.fastq |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 5970607 |
| Sequences flagged as poor quality | 0 |
| Sequence length | 36 |
| %GC | 50 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTG | 306866 | 5.1396114331423925 | TruSeq Adapter, Index 2 (97% over 35bp) |
| GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGA | 149609 | 2.5057586272216543 | TruSeq Adapter, Index 2 (97% over 36bp) |
| CCACAACATCCTTGGAAAAAGGATCCTGCCATGTTC | 8199 | 0.13732272112366464 | No Hit |
| CAACATCCTTGGAAAAAGGATCCTGCCATGTTCTCC | 6056 | 0.10143022309122003 | No Hit |