Bowtie seems to be working fine (tested command '/gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/bowtie2 --version' [2.3.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.9/samtools' Reference genome folder provided is /gscratch/srlab/sam/data/C_virginica/genomes/ (absolute path is '/gscratch/srlab/sam/data/C_virginica/genomes/)' Processing sequences up to read no. 5000000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Input files to be analysed (in current folder '/gscratch/scrubbed/samwhite/outputs/20190222_cvirginica_se_bismark/subset_5000000'): /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_R1.fastq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Current working directory is: /gscratch/scrubbed/samwhite/outputs/20190222_cvirginica_se_bismark/subset_5000000 Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sam/data/C_virginica/genomes/ Single-core mode: setting pid to 1 Single-end alignments will be performed ======================================= Input file is in FastQ format Processing reads up to sequence no. 5000000 from /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_R1.fastq.gz Writing a C -> T converted version of the input file cvir_bsseq_all_R1.fastq.gz to cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file cvir_bsseq_all_R1.fastq.gz (5000001 sequences in total) Input file is cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sam/data/C_virginica/genomes/ with the specified options: -q --score-min L,0,-0.6 -p 28 --reorder --ignore-quals Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq with options -q --score-min L,0,-0.6 -p 28 --reorder --ignore-quals --norc) Using Bowtie 2 index: /gscratch/srlab/sam/data/C_virginica/genomes/Bisulfite_Genome/CT_conversion/BS_CT Found first alignment: M03631:341:000000000-BLY9V:1:1101:13318:1785_1:N:0:32 0 NC_035780.1_CT_converted 13737422 0 76M * 0 0 TTTAGTTTTAGTTTGTATATTTTTTTTTAGTTGTATTTTTTTTTATAATTTTATATTAAGATGTGTGTGTAAGAAT CCCCCGGGGGGGGGGGFFCFGGGGGGGG8,CE,C,CEEFFEFEG,,,,>> Writing bisulfite mapping results to cvir_bsseq_all_R1_bismark_bt2.bam <<< Reading in the sequence file /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_R1.fastq.gz Processed 1000000 sequences so far Processed 2000000 sequences so far Processed 3000000 sequences so far Processed 4000000 sequences so far 5000000 reads; of these: 5000000 (100.00%) were unpaired; of these: 3981394 (79.63%) aligned 0 times 416392 (8.33%) aligned exactly 1 time 602214 (12.04%) aligned >1 times 20.37% overall alignment rate 5000000 reads; of these: 5000000 (100.00%) were unpaired; of these: 3979770 (79.60%) aligned 0 times 417658 (8.35%) aligned exactly 1 time 602572 (12.05%) aligned >1 times 20.40% overall alignment rate Processed 5000000 sequences so far Successfully deleted the temporary file cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq Final Alignment report ====================== Sequences analysed in total: 5000000 Number of alignments with a unique best hit from the different alignments: 932056 Mapping efficiency: 18.6% Final Cytosine Methylation Report ================================= Total number of C's analysed: 13856975 Total methylated C's in CpG context: 1398936 Total methylated C's in CHG context: 104800 Total methylated C's in CHH context: 830345 Total methylated C's in Unknown context: 5744 Total unmethylated C's in CpG context: 543601 Total unmethylated C's in CHG context: 2810688 Total unmethylated C's in CHH context: 8168605 Total unmethylated C's in Unknown context: 31261 C methylated in CpG context: 72.0% C methylated in CHG context: 3.6% C methylated in CHH context: 9.2% C methylated in Unknown context (CN or CHN): 15.5% Bismark completed in 0d 0h 12m 47s ==================== Bismark run complete ====================