Bowtie seems to be working fine (tested command '/gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/bowtie2 --version' [2.3.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.9/samtools' Reference genome folder provided is /gscratch/srlab/sam/data/C_virginica/genomes/ (absolute path is '/gscratch/srlab/sam/data/C_virginica/genomes/)' Processing sequences up to read no. 100000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Input files to be analysed (in current folder '/gscratch/scrubbed/samwhite/outputs/20190222_cvirginica_se_bismark/subset_100000'): /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_R1.fastq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Current working directory is: /gscratch/scrubbed/samwhite/outputs/20190222_cvirginica_se_bismark/subset_100000 Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sam/data/C_virginica/genomes/ Single-core mode: setting pid to 1 Single-end alignments will be performed ======================================= Input file is in FastQ format Processing reads up to sequence no. 100000 from /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_R1.fastq.gz Writing a C -> T converted version of the input file cvir_bsseq_all_R1.fastq.gz to cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file cvir_bsseq_all_R1.fastq.gz (100001 sequences in total) Input file is cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sam/data/C_virginica/genomes/ with the specified options: -q --score-min L,0,-0.6 -p 28 --reorder --ignore-quals Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq with options -q --score-min L,0,-0.6 -p 28 --reorder --ignore-quals --norc) Using Bowtie 2 index: /gscratch/srlab/sam/data/C_virginica/genomes/Bisulfite_Genome/CT_conversion/BS_CT Found first alignment: M03631:341:000000000-BLY9V:1:1101:13318:1785_1:N:0:32 0 NC_035780.1_CT_converted 13737422 0 76M * 0 0 TTTAGTTTTAGTTTGTATATTTTTTTTTAGTTGTATTTTTTTTTATAATTTTATATTAAGATGTGTGTGTAAGAAT CCCCCGGGGGGGGGGGFFCFGGGGGGGG8,CE,C,CEEFFEFEG,,,,>> Writing bisulfite mapping results to cvir_bsseq_all_R1_bismark_bt2.bam <<< Reading in the sequence file /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_R1.fastq.gz 100000 reads; of these: 100000 (100.00%) were unpaired; of these: 79738 (79.74%) aligned 0 times 8286 (8.29%) aligned exactly 1 time 11976 (11.98%) aligned >1 times 20.26% overall alignment rate 100000 reads; of these: 100000 (100.00%) were unpaired; of these: 80027 (80.03%) aligned 0 times 8121 (8.12%) aligned exactly 1 time 11852 (11.85%) aligned >1 times 19.97% overall alignment rate Successfully deleted the temporary file cvir_bsseq_all_R1.fastq.gz_C_to_T.fastq Final Alignment report ====================== Sequences analysed in total: 100000 Number of alignments with a unique best hit from the different alignments: 18487 Mapping efficiency: 18.5% Final Cytosine Methylation Report ================================= Total number of C's analysed: 278946 Total methylated C's in CpG context: 29321 Total methylated C's in CHG context: 2414 Total methylated C's in CHH context: 18296 Total methylated C's in Unknown context: 124 Total unmethylated C's in CpG context: 9435 Total unmethylated C's in CHG context: 55484 Total unmethylated C's in CHH context: 163996 Total unmethylated C's in Unknown context: 620 C methylated in CpG context: 75.7% C methylated in CHG context: 4.2% C methylated in CHH context: 10.0% C methylated in Unknown context (CN or CHN): 16.7% Bismark completed in 0d 0h 0m 35s ==================== Bismark run complete ====================