Bowtie seems to be working fine (tested command '/gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/bowtie2 --version' [2.3.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.9/samtools' Reference genome folder provided is /gscratch/srlab/sam/data/C_virginica/genomes/ (absolute path is '/gscratch/srlab/sam/data/C_virginica/genomes/)' Processing sequences up to read no. 1000000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Input files to be analysed (in current folder '/gscratch/scrubbed/samwhite/outputs/20190222_cvirginica_pe_bismark/subset_1000000'): /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R1.fastq.gz /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R2.fastq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Current working directory is: /gscratch/scrubbed/samwhite/outputs/20190222_cvirginica_pe_bismark/subset_1000000 Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sam/data/C_virginica/genomes/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R1.fastq.gz and /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R2.fastq.gz Input files are in FastQ format Processing reads up to sequence no. 1000000 from /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R1.fastq.gz Writing a C -> T converted version of the input file cvir_bsseq_all_pe_R1.fastq.gz to cvir_bsseq_all_pe_R1.fastq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file cvir_bsseq_all_pe_R1.fastq.gz (1000001 sequences in total) Processing reads up to sequence no. 1000000 from /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R2.fastq.gz Writing a G -> A converted version of the input file cvir_bsseq_all_pe_R2.fastq.gz to cvir_bsseq_all_pe_R2.fastq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file cvir_bsseq_all_pe_R2.fastq.gz (1000001 sequences in total) Input files are cvir_bsseq_all_pe_R1.fastq.gz_C_to_T.fastq and cvir_bsseq_all_pe_R2.fastq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sam/data/C_virginica/genomes/ with the specified options: -q --score-min L,0,-0.6 -p 28 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from cvir_bsseq_all_pe_R1.fastq.gz_C_to_T.fastq and cvir_bsseq_all_pe_R2.fastq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 28 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: M03631:341:000000000-BLY9V:1:1101:13318:1785_1:N:0:32/1 99 NC_035780.1_CT_converted 13669642 0 76M = 13669704 138 TTTAGTTTTAGTTTGTATATTTTTTTTTAGTTGTATTTTTTTTTATAATTTTATATTAAGATGTGTGTGTAAGAAT CCCCCGGGGGGGGGGGFFCFGGGGGGGG8,CE,C,CEEFFEFEG,,,,>> Writing bisulfite mapping results to cvir_bsseq_all_pe_R1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R1.fastq.gz and /gscratch/scrubbed/samwhite/data/C_virginica/BSseq/cvir_bsseq_all_pe_R2.fastq.gz 1000000 reads; of these: 1000000 (100.00%) were paired; of these: 890542 (89.05%) aligned concordantly 0 times 49733 (4.97%) aligned concordantly exactly 1 time 59725 (5.97%) aligned concordantly >1 times 10.95% overall alignment rate 1000000 reads; of these: 1000000 (100.00%) were paired; of these: 890295 (89.03%) aligned concordantly 0 times 50232 (5.02%) aligned concordantly exactly 1 time 59473 (5.95%) aligned concordantly >1 times 10.97% overall alignment rate Processed 1000000 sequence pairs so far Processed 1000000 sequences in total Successfully deleted the temporary files cvir_bsseq_all_pe_R1.fastq.gz_C_to_T.fastq and cvir_bsseq_all_pe_R2.fastq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 1000000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 3508701 Total methylated C's in CpG context: 368046 Total methylated C's in CHG context: 14116 Total methylated C's in CHH context: 83124 Total methylated C's in Unknown context: 1043 Total unmethylated C's in CpG context: 135870 Total unmethylated C's in CHG context: 761025 Total unmethylated C's in CHH context: 2146520 Total unmethylated C's in Unknown context: 12645 C methylated in CpG context: 73.0% C methylated in CHG context: 1.8% C methylated in CHH context: 3.7% C methylated in unknown context (CN or CHN): 7.6% Bismark completed in 0d 0h 3m 44s ==================== Bismark run complete ====================