# Please cite: Mario Stanke, Mark Diekhans, Robert Baertsch, David Haussler (2008),
# Using native and syntenically mapped cDNA alignments to improve de novo gene finding
# Bioinformatics 24: 637-644, doi 10.1093/bioinformatics/btn013
# No extrinsic information on sequences given.
# Initialising the parameters using config directory /augustus/config/ ...
# Using protein profile unknown
# --[0..88]--> unknown_A (11) <--[0..1]--> unknown_B (24) <--[1..3]--> unknown_C (12) <--[5..14]--> unknown_D (17) <--[16..25]--> unknown_G (12) <--[7..43]--> unknown_H (13) <--[6..36]--> unknown_I (31) <--[0..2]--> unknown_J (23) <--[0..1]--> unknown_K (17) <--[1..70]--> unknown_L (13) <--[3..5]--> unknown_M (12) <--[1..24]--> unknown_N (24) <--[0..41]--> unknown_O (36) <--[9..36]--> unknown_Q (8) <--[5..12]--> unknown_R (8) <--[0..1]--> unknown_S (12) <--[0..146]--
# BUSCO_20180911_busco_2432604931 version. Using default transition matrix.
# admissible start codons and their probabilities: ATG(1), CTG(0), TTG(0)
# Looks like ./tmp/Contig5429320180911_busco_2432604931_.temp is in fasta format.
# We have hints for 0 sequences and for 0 of the sequences in the input set.
#
# ----- prediction on sequence number 1 (length = 23456, name = Contig54293) -----
#
# Constraints/Hints:
# (none)
# Predicted genes for sequence number 1 on both strands
# start gene g1
Contig54293	AUGUSTUS	gene	3281	4294	0.18	-	.	g1
Contig54293	AUGUSTUS	transcript	3281	4294	0.18	-	.	g1.t1
Contig54293	AUGUSTUS	stop_codon	3281	3283	.	-	0	transcript_id "g1.t1"; gene_id "g1";
Contig54293	AUGUSTUS	intron	3425	3857	0.96	-	.	transcript_id "g1.t1"; gene_id "g1";
Contig54293	AUGUSTUS	intron	3979	4241	0.18	-	.	transcript_id "g1.t1"; gene_id "g1";
Contig54293	AUGUSTUS	CDS	3281	3424	1	-	0	transcript_id "g1.t1"; gene_id "g1";
Contig54293	AUGUSTUS	CDS	3858	3978	0.56	-	1	transcript_id "g1.t1"; gene_id "g1";
Contig54293	AUGUSTUS	CDS	4242	4294	0.18	-	0	transcript_id "g1.t1"; gene_id "g1";
Contig54293	AUGUSTUS	start_codon	4292	4294	.	-	0	transcript_id "g1.t1"; gene_id "g1";
# coding sequence = [atgtcacctcattttccgttttgctacccaagggtttatttcattactcacacgtataaggaagaaaacgttccccatc
# atccctgcatgaggctggtgtctaactgtgagcaggtgatgaacctgaggatctcccggcgcctgatcaccatggaaaaatgtcagccttacagggaa
# gaccagtgtctcgccagtcacaccaacgtgaaccactacctgaatgcctcgttcagagaaatgtatttcaaagcggtagaaaatcctcaaaaatctcc
# caagtctgataggaagtcacaaaccgacacaaaaccgccctaa]
# protein sequence = [MSPHFPFCYPRVYFITHTYKEENVPHHPCMRLVSNCEQVMNLRISRRLITMEKCQPYREDQCLASHTNVNHYLNASFR
# EMYFKAVENPQKSPKSDRKSQTDTKPP]
# end gene g1
###
# command line:
# /augustus/bin/augustus --codingseq=1 --proteinprofile=eukaryota_odb9/prfl/EOG09370AS9.prfl --predictionStart=0  --predictionEnd=37429  --species=BUSCO_20180911_busco_2432604931 ./tmp/Contig5429320180911_busco_2432604931_.temp