Program options for ShortStack: 

usage: ShortStack [-h] [--version] --genomefile GENOMEFILE
                  [--known_miRNAs KNOWN_MIRNAS]
                  (--readfile [READFILE ...] | --bamfile [BAMFILE ...])
                  [--outdir OUTDIR] [--adapter ADAPTER | --autotrim]
                  [--autotrim_key AUTOTRIM_KEY] [--threads THREADS]
                  [--mmap {u,f,r}] [--align_only] [--show_secondaries]
                  [--dicermin DICERMIN] [--dicermax DICERMAX]
                  [--locifile LOCIFILE | --locus LOCUS] [--nohp] [--dn_mirna]
                  [--strand_cutoff STRAND_CUTOFF] [--mincov MINCOV]
                  [--pad PAD]

options:
  -h, --help            show this help message and exit
  --version             show program's version number and exit
  --genomefile GENOMEFILE
                        FASTA file of the reference genome (required)
  --known_miRNAs KNOWN_MIRNAS
                        FASTA file of known/suspected mature microRNAs
  --readfile [READFILE ...]
                        One or more files of reads (fq, fa, gzip OK)
  --bamfile [BAMFILE ...]
                        One or more BAM alignment files
  --outdir OUTDIR       Output directory name. Defaults to ShortStack_time
  --adapter ADAPTER     3-primer adapter sequence to trim off ofreads. If
                        given applies to all input fastq files. Mutually
                        exclusive with --autotrim.
  --autotrim            If this switch is set, automatically discover the
                        3-prime adapter from each input readfile, and trim it.
                        This uses the sequence from --autotrim_key to discover
                        the adapter sequence. Mutually exlcusive with
                        --adapter.
  --autotrim_key AUTOTRIM_KEY
                        Sequence of an abundant, known small RNA to be used to
                        discover the 3-prime adapter sequence. Has no effect
                        unless --autotrim is specified. Defaults to
                        TCGGACCAGGCTTCATTCCCC (miR166). Can be upper or lower-
                        case, T or U and must be 20-30 bases long.
  --threads THREADS     Number of threads to use (integer) - default: 1
  --mmap {u,f,r}        Protocol for multi-mapped reads: u, f, or r - default:
                        u
  --align_only          If this switch is set, ShortStack quits after
                        performing alignments without any analyses performed.
  --show_secondaries    If this switch is set, ShortStack will retain
                        secondary alignments for multimapped reads. This will
                        increase bam file size, possibly by a lot.
  --dicermin DICERMIN   Minimum size of a valid Dicer-processed small RNA.
                        Must be integer >= 15 and <= dicermax. Default: 20.
  --dicermax DICERMAX   Maximum size of a valid Dicer-processed small RNA.
                        Must be integer >= 15 and <= dicermax. Default: 24.
  --locifile LOCIFILE   File listing intervals to analyze. Can be simple tab-
                        delimited, .bed, or .gff3. Tab-delimited format is
                        column 1 with coordinates Chr:start-stop, column 2
                        with names. Input file assumed to be simple tab-
                        delimited unless file name ends in .bed or .gff3.
                        Mutually exclusive with --locus.
  --locus LOCUS         Analyze the specified interval, given in format
                        Chr:start-stop. Mutually exclusive with --locifile.
  --nohp                If this switch is set, RNA folding will not take
                        place, thus MIRNA loci cannot be annotated. This does
                        however save CPU time.
  --dn_mirna            If this switch is set, a de novo search for new MIRNA
                        loci will be performed. By default, de novo MIRNA
                        finding is not performed and MIRNA searches are
                        limited to loci matching RNAs from --known_miRNAs that
                        align to the genome
  --strand_cutoff STRAND_CUTOFF
                        Cutoff for calling the strandedness of a small RNA
                        locus. Must be a floating point > 0.5 and < 1.
                        Default: 0.8.
  --mincov MINCOV       Minimum alignment depth required to nucleate a small
                        RNA cluster during de novo cluster search. In units of
                        reads per million. Must be a floating point number.
                        Default: 0.5
  --pad PAD             Initial peaks (continuous regions with depth exceeding
                        argument mincov are merged if they are this distance
                        or less from each other. Must be an integer >= 1.
                        Default: 75


----------------------------------------------