________          __              
              / ____/ /__  _  __/ /_  ____ ______
             / /_  / / _ \| |/ / __ \/ __ `/ ___/
            / __/ / /  __/>  </ /_/ / /_/ / /    
           /_/   /_/\___/_/|_/_.___/\__._/_/     

Flexbar - flexible barcode and adapter removal, version 3.5.0
Developed with SeqAn, the library for sequence analysis

Available on github.com/seqan/flexbar


Local time:            Wed May 24 10:48:12 2023

Number of threads:     40
Bundled fragments:     256

Target name:           sRNA-ACR-140-S1-TP2_R1_001-adapter-and-length-50
File type:             fastq
Reads file:            /home/shared/8TB_HDD_01/sam/data/A_pulchra/sRNAseq/sRNA-ACR-140-S1-TP2_R1_001.fastq.gz
Reads file 2:          /home/shared/8TB_HDD_01/sam/data/A_pulchra/sRNAseq/sRNA-ACR-140-S1-TP2_R2_001.fastq.gz   (paired run)
Adapter file:          /home/shared/8TB_HDD_01/sam/data/A_pulchra/sRNAseq/NEB-adapters.fasta

max-uncalled:          0
post-trim-length:      50
min-read-length:       18

adapter-pair-overlap:  ON
adapter-trim-end:      RIGHT
adapter-min-overlap:   3
adapter-min-poverlap:  40
adapter-error-rate:    0.1
adapter-match:         1
adapter-mismatch:     -1
adapter-gap:          -6

Adapter:               Sequence:
first                  AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
second                 GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT


Processing reads ...done.

Elapsed time:       3 min 49 sec
Processing speed:   161632 reads/s


Min, max, mean and median overlap of paired reads: 40 / 149 / 54 / 44

Adapter removal statistics
==========================
Adapter:            Overlap removal:    Full length:
first               17854577            17749958
second              17688528            17594166

Min, max, mean and median overlap: 1 / 60 / 44 / 34


Output file statistics
======================
Read file:               sRNA-ACR-140-S1-TP2_R1_001-adapter-and-length-50_1.fastq.gz
  written reads          17551962
  short reads            948699
Read file 2:             sRNA-ACR-140-S1-TP2_R1_001-adapter-and-length-50_2.fastq.gz
  written reads          17551962
  short reads            941364


Filtering statistics
====================
Processed reads                   37013944
  skipped due to uncalled bases      10070   (5373 uncalled in 5035 pairs)
  short prior to adapter removal         0
  finally skipped short reads      1890063
  skipped paired single reads         9887
Discarded reads overall            1910020
Remaining reads                   35103924   (94%)

Processed bases   5552091600
Remaining bases   1048763452   (18% of input)


Flexbar completed adapter removal.